Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5394

expand all nodes | collapse all nodes | view schema

Name Class

Expr5394Expression_of (2)
HomolHomol_homolF27C1:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (14)
TypeReporter_gene[C30H7.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTGTCACCTGAAATGTTCGTT] 3' and primer B 5' [CCACCGCAGGATTTCTGA] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons;
RemarkStrain: BC14389
ReferenceWBPaper00006525
TransgeneWBTransgene00003529