WormBase Tree Display for Expr_pattern: Expr5380
expand all nodes | collapse all nodes | view schema
Expr5380 | Expression_of | Gene | WBGene00016230 | Inferred_automatically | |
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00016230 | ||||
Homol | Homol_homol | C29G2:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005733 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005772 | |||||
WBbt:0006748 | |||||
Type | Reporter_gene | [C29G2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATGCCTTGACTTTTCTGCT] 3' and primer B 5' [GAAATGTCCATTCCATGATGC] 3'. | |||
Pattern | Adult Expression: Reproductive System; vulva other; hypodermis; | ||||
Larval Expression: intestine; hypodermis; unidentified cells in head; | |||||
Remark | Strain: BC15484 | ||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003985 | ||||
Historical_gene | WBGene00016229 | Note: This object originally referred to WBGene00016229. WBGene00016229 is now considered dead and has been merged into WBGene00016230. WBGene00016230 has replaced WBGene00016229 accordingly. |