WormBase Tree Display for Expr_pattern: Expr5380

Expr5380 Expression_of: Gene: WBGene00016230 Inferred_automatically
    Reflects_endogenous_expression_of: WBGene00016230
  Homol: Homol_homol: C29G2:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005733
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005747
      WBbt:0005772
      WBbt:0006748
  Type: Reporter_gene: [C29G2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATGCCTTGACTTTTCTGCT] 3' and primer B 5' [GAAATGTCCATTCCATGATGC] 3'.
  Pattern: Adult Expression: Reproductive System; vulva other; hypodermis;
    Larval Expression: intestine; hypodermis; unidentified cells in head;
  Remark: Strain: BC15484
  Reference: WBPaper00006525
  Transgene: WBTransgene00003985
  Historical_gene: WBGene00016229 Note: This object originally referred to WBGene00016229. WBGene00016229 is now considered dead and has been merged into WBGene00016230. WBGene00016230 has replaced WBGene00016229 accordingly.