WormBase Tree Display for Expr_pattern: Expr5377
expand all nodes | collapse all nodes | view schema
| Expr5377 | Expression_of | Gene | WBGene00007801 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00007801 | ||
| Homol | Homol_homol | CHROMOSOME_IV:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0005772 | |||
| WBbt:0005799 | |||
| Type | Reporter_gene | [C29E6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTCTGACGTTCATGATATGG] 3' and primer B 5' [GGACTCTAAATTGGCGAACTG] 3'. | |
| Pattern | Adult Expression: pharynx; intestine; rectal gland cells; | ||
| Larval Expression: pharynx; intestine; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC13371 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003149 |
