WormBase Tree Display for Expr_pattern: Expr5347
expand all nodes | collapse all nodes | view schema
| Expr5347 | Expression_of | Gene | WBGene00016158 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00016158 | ||
| Homol | Homol_homol | C27A12:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [C27A12.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCTTAAACTTACTGGTGCTCTC] 3' and primer B 5' [TCGTCGGAACTGATTCTAAAAGT] 3'. | |
| Pattern | Adult Expression: intestine; unidentified cells in head; | ||
| Larval Expression: intestine; body wall muscle; | |||
| Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. | ||
| Strain: BC11189 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002520 |
