WormBase Tree Display for Expr_pattern: Expr5315
expand all nodes | collapse all nodes | view schema
Expr5315 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | C23G10:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005772 | Partial | |||
Remark | ant and post cells | ||||
Type | Reporter_gene | [rpn-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGGAAACATAAAACGCCTA] 3' and primer B 5' [TTCAACAATGTCAAGATCTGAAA] 3'. | |||
Pattern | Adult Expression: intestine - ant and post cells; | ||||
Larval Expression: intestine - ant and post cells; | |||||
Remark | Strain: BC10255 | ||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002159 |