WormBase Tree Display for Expr_pattern: Expr5315
expand all nodes | collapse all nodes | view schema
Expr5315 | Expression_of | Gene | WBGene00004459 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004459 | ||
Homol | Homol_homol | C23G10:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [rpn-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGGAAACATAAAACGCCTA] 3' and primer B 5' [TTCAACAATGTCAAGATCTGAAA] 3'. | |
Pattern | Adult Expression: intestine - ant and post cells; | ||
Larval Expression: intestine - ant and post cells; | |||
Remark | Strain: BC10255 | ||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002159 |