Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5291

expand all nodes | collapse all nodes | view schema

Name Class

Expr5291Expression_ofGeneWBGene00015920
Reflects_endogenous_expression_ofWBGene00015920
Expression_data (2)
TypeReporter_gene[C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.
Strain: BC10173
ReferenceWBPaper00006525
TransgeneWBTransgene00002123