WormBase Tree Display for Expr_pattern: Expr5291
expand all nodes | collapse all nodes | view schema
Expr5291 | Expression_of | Gene | WBGene00015920 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015920 | ||
Expression_data (2) | |||
Type | Reporter_gene | [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'. | |
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC10173 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002123 |