WormBase Tree Display for Expr_pattern: Expr5268
expand all nodes | collapse all nodes | view schema
| Expr5268 | Expression_of | Gene | WBGene00015789 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00015789 | ||
| Homol | Homol_homol | C15C7:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'. | |
| Pattern | Adult Expression: intestine; anal sphincter; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; | ||
| Larval Expression: intestine; anal sphincter; rectal epithelium; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; | |||
| Picture | WBPicture0000009246 | ||
| WBPicture0000009247 | |||
| WBPicture0000009248 | |||
| WBPicture0000009249 | |||
| WBPicture0000009250 | |||
| WBPicture0000009251 | |||
| Remark | Also expressed in (comments from author) : Unidentified in head might be amphid socket cells?Embryo incomplete. To be updated. | ||
| Strain: BC10468 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002271 |
