Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5248

expand all nodes | collapse all nodes | view schema

Name Class

Expr5248Expression_ofGeneWBGene00015734
Reflects_endogenous_expression_ofWBGene00015734
HomolHomol_homolC13B9:Expr
Expression_data (2)
TypeReporter_gene[C13B9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTATGACAAAATTTCTACGCGA] 3' and primer B 5' [CGGCGATCAACACGATTG] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; ventral nerve cord; unidentified cells in body ;
Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in body ;
RemarkAlso expressed in (comments from author) : High intensity GFP may mask tissues.
Strain: BC10894
ReferenceWBPaper00006525
TransgeneWBTransgene00002414