Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5234

expand all nodes | collapse all nodes | view schema

Name Class

Expr5234Expression_of (2)
HomolHomol_homolC10G8:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[C10G8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTAATTCTCCAGAATCGCAACT] 3' and primer B 5' [TATCGAGCCCTACGGAATTTTA] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ;
Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ;
RemarkStrain: BC14107
ReferenceWBPaper00006525
TransgeneWBTransgene00003403