Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5192

expand all nodes | collapse all nodes | view schema

Name Class

Expr5192Expression_ofGeneWBGene00015551
Reflects_endogenous_expression_ofWBGene00015551
HomolHomol_homolC06G3:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (16)
TypeReporter_gene[C06G3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAATTTTTGTAGAAAGTGTGGG] 3' and primer B 5' [TTTGTCGATTTTGAACTTGGG] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons;
Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons;
Picture (4)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15491
ReferenceWBPaper00006525
TransgeneWBTransgene00003989