WormBase Tree Display for Expr_pattern: Expr5191
expand all nodes | collapse all nodes | view schema
| Expr5191 | Expression_of (2) | ||
|---|---|---|---|
| Homol | Homol_homol | F43B10:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0003822 | |||
| WBbt:0003833 | |||
| WBbt:0004292 | |||
| WBbt:0005753 | |||
| WBbt:0005813 | |||
| WBbt:0005821 | |||
| WBbt:0005828 | |||
| Type | Reporter_gene | [C06G1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATAAAATCTGCGCTGTGC] 3' and primer B 5' [ACCCTTTGCTCTCGCAAGT] 3'. | |
| Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; vulval muscle; gonad sheath cells; body wall muscle; seam cells; | ||
| Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; seam cells; | |||
| Remark | Strain: BC14332 | ||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003506 | ||
| Historical_gene | WBGene00015548 | Note: This object originally referred to WBGene00015548. WBGene00015548 is now considered dead and has been merged into WBGene00018373. WBGene00018373 has replaced WBGene00015548 accordingly. |
