Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5152

expand all nodes | collapse all nodes | view schema

Name Class

Expr5152Expression_ofGeneWBGene00004040
Reflects_endogenous_expression_ofWBGene00004040
HomolHomol_homolC04G6:Expr
Expression_data (2)
TypeReporter_gene[pld-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTAGTTTTGCATCCTTTTTGC] 3' and primer B 5' [TCTTCGCTCTCGATATTTCTGTC] 3'.
PatternAdult Expression: pharynx; body wall muscle; Nervous System; nerve ring; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; tail neurons;
RemarkAlso expressed in (comments from author) : Expression in pharynx is anterior only.
Strain: BC11514
ReferenceWBPaper00006525
TransgeneWBTransgene00002384