Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5133

expand all nodes | collapse all nodes | view schema

Name Class

Expr5133Expression_ofGeneWBGene00015391
Reflects_endogenous_expression_ofWBGene00015391
HomolHomol_homolD2021:Expr
Expression_data (2)
TypeReporter_gene[C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'.
PatternAdult Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; tail neurons; unidentified cells;
RemarkAlso expressed in (comments from author) : Adult and larval have expression in either the seam cells or H cell but it was difficult to determine. There is also occassional mosaic expression in the body wall muscle.
Strain: BC10570
ReferenceWBPaper00006525
TransgeneWBTransgene00002317