WormBase Tree Display for Expr_pattern: Expr5133
expand all nodes | collapse all nodes | view schema
Expr5133 | Expression_of | Gene | WBGene00015391 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015391 | ||
Homol | Homol_homol | D2021:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | |
Pattern | Adult Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons; | ||
Larval Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; tail neurons; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Adult and larval have expression in either the seam cells or H cell but it was difficult to determine. There is also occassional mosaic expression in the body wall muscle. | ||
Strain: BC10570 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002317 |