Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5123

expand all nodes | collapse all nodes | view schema

Name Class

Expr5123Expression_of (2)
HomolHomol_homolC03C10:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[C03C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAGTTTTCGTGAATCCTCCT] 3' and primer B 5' [ATTGTTTGCTCTGATCGTGCT] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Some punctate pattern in head and tail that may be neural.
Strain: BC12276
ReferenceWBPaper00006525
TransgeneWBTransgene00004285