WormBase Tree Display for Expr_pattern: Expr5123
expand all nodes | collapse all nodes | view schema
Expr5123 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C03C10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (11) | |||
Type | Reporter_gene | [C03C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAGTTTTCGTGAATCCTCCT] 3' and primer B 5' [ATTGTTTGCTCTGATCGTGCT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Some punctate pattern in head and tail that may be neural. | ||
Strain: BC12276 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004285 |