Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5086

expand all nodes | collapse all nodes | view schema

Name Class

Expr5086Expression_ofGeneWBGene00000817
Reflects_endogenous_expression_ofWBGene00000817
HomolHomol_homolB0547:Expr
Expression_data (2)
TypeReporter_gene[csn-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCCTTTAAGACCCAAAAGAAT] 3' and primer B 5' [ATCAACTTCGATCGTCTGAAAAA] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; body wall muscle; unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC10449
ReferenceWBPaper00006525
TransgeneWBTransgene00002265