Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5079

expand all nodes | collapse all nodes | view schema

Name Class

Expr5079Expression_ofGeneWBGene00015217
Reflects_endogenous_expression_ofWBGene00015217
HomolHomol_homolB0496:Expr
Expression_data (2)
TypeReporter_gene[B0496.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTCAAAGATCGGTTATCTTTTGT] 3' and primer B 5' [GTGACGTCGGTGATTACTGAAA] 3'.
PatternAdult Expression: pharyngeal-intestinal valve; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharyngeal-intestinal valve; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC10431
ReferenceWBPaper00006525
TransgeneWBTransgene00002251