Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5076

expand all nodes | collapse all nodes | view schema

Name Class

Expr5076Expression_ofGeneWBGene00004980
Reflects_endogenous_expression_ofWBGene00004980
HomolHomol_homolF54C8:Expr
Expression_data (2)
TypeReporter_gene[spk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGAAGTTGGTGACGAGTCTTG] 3' and primer B 5' [TCCGCCGATATTCTACACTTAAA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ;
RemarkStrain: BC15735
ReferenceWBPaper00006525
TransgeneWBTransgene00004077