WormBase Tree Display for Expr_pattern: Expr5065
expand all nodes | collapse all nodes | view schema
Expr5065 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | B0403:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005733 | ||||
WBbt:0005735 | |||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0005788 | |||||
WBbt:0005813 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [B0403.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTGAAAATTATCAAAACTTCG] 3' and primer B 5' [AGCCATGACGATCCACTAATCT] 3'. | |||
Pattern | Adult Expression: pharyngeal gland cells; intestine; Nervous System; tail neurons; unidentified cells in tail ; | ||||
Larval Expression: pharyngeal gland cells; intestine; body wall muscle; hypodermis; | |||||
Picture | WBPicture0000003571 | ||||
WBPicture0000003572 | |||||
WBPicture0000003573 | |||||
WBPicture0000003574 | |||||
WBPicture0000003575 | |||||
WBPicture0000003576 | |||||
WBPicture0000003577 | |||||
Remark | Also expressed in (comments from author) : Neural in tails is the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). | ||||
Strain: BC13607 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003225 |