WormBase Tree Display for Expr_pattern: Expr5061
expand all nodes | collapse all nodes | view schema
Expr5061 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | B0393:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0003822 | |||
WBbt:0003833 | |||
WBbt:0004292 | |||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0005813 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [rps-0::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGGTGAAAGGAACGACA] 3' and primer B 5' [GGCACCGCCTGAGATATTAC] 3'. | |
Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; Nervous System; tail neurons; | ||
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; tail neurons; | |||
Picture | WBPicture0000003565 | ||
WBPicture0000003566 | |||
WBPicture0000003567 | |||
WBPicture0000003568 | |||
Remark | Also expressed in (comments from author) : high intensity GFP, other tissues may be masked | ||
Strain: BC13748 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004518 |