WormBase Tree Display for Expr_pattern: Expr5055
expand all nodes | collapse all nodes | view schema
Expr5055 | Expression_of | Gene | WBGene00000182 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000182 | ||
Homol | Homol_homol | B0336:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (24) | |||
Type | Reporter_gene | [arf-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCGTTTATTATTGTTGCCTAT] 3' and primer B 5' [CCGAACACGTTTCCGATT] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : possibly labial sensillia in head. Hard to see because GFP in other tissues is masking things. | ||
Strain: BC12796 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003017 |