Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5055

expand all nodes | collapse all nodes | view schema

Name Class

Expr5055Expression_ofGeneWBGene00000182
Reflects_endogenous_expression_ofWBGene00000182
HomolHomol_homolB0336:Expr
Expression_data (2)
TypeReporter_gene[arf-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCGTTTATTATTGTTGCCTAT] 3' and primer B 5' [CCGAACACGTTTCCGATT] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; labial sensilla; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; head neurons; labial sensilla; tail neurons;
RemarkAlso expressed in (comments from author) : possibly labial sensillia in head. Hard to see because GFP in other tissues is masking things.
Strain: BC12796
ReferenceWBPaper00006525
TransgeneWBTransgene00003017