WormBase Tree Display for Expr_pattern: Expr5025
expand all nodes | collapse all nodes | view schema
Expr5025 | Expression_of | Gene | WBGene00015062 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015062 | ||
Homol | Homol_homol | B0228:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [B0228.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGACCATGATTTTGAGTCG] 3' and primer B 5' [TACCATATCAGCAAGCTCCAGA] 3'. | |
Pattern | Adult Expression: intestine - anterior cells; | ||
Larval Expression: intestine - anterior cells; | |||
Remark | Also expressed in (comments from author) : difficult to detect of embryo is expressing | ||
Strain: BC13081 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004429 |