WormBase Tree Display for Expr_pattern: Expr10014

Expr10014 Expression_of: Gene: WBGene00006477
    Reflects_endogenous_expression_of: WBGene00006477
  Expression_data: Life_stage: WBls:0000024
      WBls:0000003
      WBls:0000038
      WBls:0000027
      WBls:0000035
      WBls:0000041
    Anatomy_term: WBbt:0003681 Certain
      WBbt:0003732 Certain
      WBbt:0005772 Certain
      WBbt:0005776 Uncertain
      WBbt:0007028 Certain
    GO_term: GO:0005886
      GO:0005769
      GO:0005764
      GO:0005794
      GO:0030139
  Subcellular_localization: The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4- 64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, inmmunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92).
    The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4-64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, immunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92).
  Type: Reporter_gene: [ChUP-1::GFP] translational fusion. ChUP-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction.
      [chup-1::GFP] translational fusion. chup-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction.
    RT_PCR
  Pattern: ChUP-1 expression was detected in all developmental stages by RT-PCR and no differences were detected in mRNA levels.
    The ChUP-1::GFP signal was especially strong all along the worm intestine. The pharynx also showed GFP signal, especially at the terminal bulb and presumably, the excretory gland cells. Although fluorescence was not as strong as that observed in other structures, GFP was also observed in embryos.
  Picture: WBPicture0000012706
    WBPicture0000012707
  Remark: The authors have changed the name of the protein described in the paper from CUP-1 to ChUP-1, given that CUP-1 was already taken by a family of genes with unknown function.
  Experiment: Strain: WBStrain00002399
  Reference: WBPaper00040950
  Transgene: WBTransgene00004294