WormBase Tree Display for Expr_pattern: Expr10000
expand all nodes | collapse all nodes | view schema
| Expr10000 | Expression_of (2) | ||
|---|---|---|---|
| Expression_data (3) | |||
| Type | In_situ | Primers for the generation of the acs-1 cDNA PCR fragment and subsequent sense and anti-sense hybridization probes were: F, atgtcacaagtggccgcaatggacc and R, aagctcggagaaatgagagac. | |
| Pattern | The expression of acs-1 in the somatic gonad but not in the germline was detected. Dark grey staining in the intestine and in somatic gonad cells indicates hybridization of the anti-sense probe to the acs-1 transcript. No hybridization signal was detected in the germline. | ||
| Reference | WBPaper00040893 | ||
| Transgene | WBTransgene00031330 |
