WormBase Tree Display for Expr_pattern: Expr6510
expand all nodes | collapse all nodes | view schema
Expr6510 | Expression_of | Gene | WBGene00003982 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00003982 | ||
Homol | Homol_homol | R11H6:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005772 | ||
Type | Reporter_gene | [R11H6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAATTGGAGCAACAAGAGTCCA] 3' and primer B 5' [CAAATCTACCGTGATTCTGGAAA] 3'. | |
Pattern | Adult Expression: intestine; | ||
Larval Expression: intestine; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11239 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002528 |