WormBase Tree Display for Construct: WBCnstr00013641
expand all nodes | collapse all nodes | view schema
| WBCnstr00013641 | Other_name | Expr8963_Ex | |
|---|---|---|---|
| Summary | [unc-94a::gfp] | ||
| Driven_by_gene | WBGene00006823 | ||
| Gene | WBGene00006823 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [unc-94a::gfp] translational fusion that contained the putative promoter regions and first exons fused in-frame to GFP. Forward and reverse primers CATTCTGCAGATTTTTCAGGTGCCGAGAGTAACATTTTCAAAC and CATTGGATCCAGTTTTAGCCTGACTCATCGCTGATGG (respectively) for isoform a. These primers were used for PCR amplification using genomic DNA as template. In the case of isoform a, 3.8 kb of sequence upstream of the predicted start methionine plus the a-specific first exon were fused in-frame to GFP. PCR product was then digested with PstI and BamHI. The fragment was ligated into the promotorless gfp vector pPD95.77, which had been previously cut with the same two restriction enzymes. --precise ends. | ||
| Clone | pPD95.77 | ||
| Used_for | Transgene_construct | WBTransgene00030831 | |
| Reference | WBPaper00032351 |
