Suehiro, Y. et al. (2019) International Worm Meeting "The analysis of behavioral choice induced by multiple odorants."

Suehiro, Y., Mitani, S.

[International Worm Meeting, 2019]

Animals can respond to multiple sensory inputs by integrating the inputs and decide the behavioral strategy. To investigate the simple mechanisms underlying the ability, we studied the calcium response in a single pair of interneurons and behavior using two kinds of attractant diacetyl (DAc) and benzaldehyde (Bz). Worms mainly sense the DAc and Bz in AWA and AWC neurons. Although the AWA neurons respond to the increase of DAc and AWC neurons respond to the removal of Bz, both the odorants induce positive chemotaxis. Because the AWA and AWC share downstream neural circuits, it is considered that the AWA and AWC generate opposite inputs to the downstream neurons. A pair of interneurons AIY are a kind of the shared neurons, that have been reported to show the elevation of calcium level by DAc and show the reduction of calcium by the removal of Bz. Therefore, to visualize the sensory integration, we swapped the odorants and measured the calcium level in AIY. As a result, we observed that the AIY neurons show transient decrease and the following elevation of calcium level, which are significantly different from the response when each odorant was proposed separately. Additionally, we previously screened for the molecules related to the behavior, which assess whether the worms stay around the local attractant or approach to far attractant using the Bz and DAc, and identified that the mgl-1 shows imbalanced behavior. Because it is identified that MGL-1 in AIY modifies the behavior by the rescue experiment, we analyzed the calcium level in the AIY neurons. As a result, MGL-1 is required not for the basic response to Bz and DAc, but for the acute response when the odorant stimuli are changed. Furthermore, we also found that hen-1, which works in AIY as a secretory protein, and RNAi of cha-1, which is required for the acetylcholine signal, in an AIY specific manner, suppress the behavioral phenotype of mgl-1. HEN-1 is reported to be received in AIA interneuron by SCD-2 and the AIA mainly projects to the AIB neurons. However, the genetic ablation of AIB did not affect the behavior. From these data, it is hypothesized that MGL-1 modulates calcium level in the AIY and regulates the behavioral strategy via the secretory protein and acetylcholine signaling.

Suehiro Y et al. (2017) MicroPubl Biol "Novel deletion alleles of a C. elegans gene Y73E7A.1, named as tm6429 and tm6475"

Mitani S, Yoshina S, Hori S, Suehiro Y

[MicroPubl Biol, 2017]

We report tm6429 and tm6475 as novel deletion alleles of the gene Y73E7A.1 that is a homologue of mammalian Coiled-coil domain containing 124 (Ccdc124)1. The Ccdc124 is a conserved gene from invertebrates to human. In human cell lines, Ccdc124 is a component of the centrosome during interphase and at the G2/M transition. During cell division, Ccdc124 relocates to the midbody at telophase and acts as an essential molecular component in cytokinesis2. The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV3. In the screening, both the alleles were detected by nested PCR using the following primer sets, 5'-GTGTGAATCGAGGAGGCGCA-3' and 5'-TTTCCAGTCCGGCAGGCGAT-3' for first round PCR and 5'- AACGGCAAACGCGCTCTATG-3' and 5'- CGTGTGCACGTGGAAGTCCA-3' for second round PCR. By Sanger sequencing, the 30bp flanking sequences of the alleles tm6429 and tm6475 were identified as TTTTAAATCGATTTTTGAGCACCAAAATTA- [355 bp deletion + 1 bp insertion (T)] - TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242 bp deletion] - TTTTATATAGGATTTTAATTTTCAGGCCAC, respectively. Based on the information about the splicing isoforms of Y73E7A.1 (WormBase, http://www.wormbase.org, WS259), the start codon of Y73E7A.1a and Y73E7A.1b transcripts are deleted in tm6429 and tm6475, respectively (Fig. 1), suggesting that those alleles may be usable for the analysis of isoform specific function.

Suehiro Y et al. (2021) Sci Rep "Efficient collection of a large number of mutations by mutagenesis of DNA damage response defective animals."

Motohashi T, Mitani S, Yoshina S, Iwata S, Suehiro Y, Dejima K

[Sci Rep, 2021]

With the development of massive parallel sequencing technology, it has become easier to establish new model organisms that are ideally suited to the specific biological phenomena of interest. Considering the history of research using classical model organisms, we believe that the efficient construction and sharing of gene mutation libraries will facilitate the progress of studies using these new model organisms. UsingC. elegans, we applied the TMP/UV mutagenesis method to animals lacking function in the DNA damage response genes atm-1 and xpc-1. This method produces genetic mutations three times more efficiently than mutagenesis of wild-type animals. Furthermore, we confirmed that the use of next-generation sequencing and the elimination of false positives through machine learning could automate the process of mutation identification with an accuracy of over 95%. Eventually, we sequenced the whole genomes of 488 strains and isolated 981 novel mutations generated by the present method; these strains have been made available to anyone who wants to use them. Since the targeted DNA damage response genes are well conserved and the mutagens used in this study are also effective in a variety of species, we believe that our method is generally applicable to a wide range of animal species.

Suehiro, Y. et al. (2013) International Worm Meeting "Odorant choice behavior and systematic reverse genetics approach to reveal molecular mechanisms underlying the behavior."

Suehiro, Y., Mitani, S.

[International Worm Meeting, 2013]

Animals integrate sensory signals, make decisions and choose proper behaviors. Although the mechanisms of the behavioral choice have been studied in various vertebrates, molecular bases underlying it have not been identified because of the complex nervous systems. Caenorhabditis elegans has simple nervous system with only 302 neurons and can perform behavioral choice. To reveal the molecules required for the behavioral choice systematically, we performed screening of genes using C.elegans. In our laboratory, 5214 mutant strains have been already isolated. Among the mutants, we selected and analyzed 1479 strains carrying mutations in genes, which are expressed in head neurons or are suggested to be involved in neural function. For the screening, we developed a novel choice assay using odorants. C. elegans shows chemotaxis toward odorants such as diacetyl (DAc) and benzaldehyde (Bz). Because an increase of DAc is received by AWA neurons and a decrease of Bz is received by AWC neurons, we performed following methods to stimulate AWA and AWC neurons simultaneously. Bz and DAc were dropped on the left and right side of an agarose plate, respectively. Then, we put worms on the spot where the diluted Bz was dropped, and counted the worms on both sides of the plate 1 hour after. During this assay, it is estimated that worms receive a decrease of Bz and increase of DAc simultaneously by moving from the initial point. When the 1:200 diluted Bz and 1:1000 diluted DAc were used as stimuli, approximate half of wild type worms were attracted to the DAc and the other worms stayed around the initial point where Bz was dropped, suggesting that our assay can be used to quantitate the behavioral choice. Under the condition, we searched for mutants, which showed abnormal choice, and found 143 mutants as candidates. To exclude mutants, which have defects in chemotaxis, we used ethanol instead of each odorant and assayed. Finally, we obtained 72 candidate genes, which have not been reported to be involved in behavioral choice. Now we are examining expression patterns of candidate genes and analyzing cell functions of some interneurons related to the odorant chemotaxis by genetic ablation.

Suehiro, Y. et al. (2017) International Worm Meeting "The analysis of neurons and molecules required for the response to multiple sensory inputs using two kinds of odorants."

Suehiro, Y., Mitani, S.

[International Worm Meeting, 2017]

Caenorhabditis elegans chooses behavioral patterns appropriately when the worms receive multiple sensory inputs. To investigate the molecules involved in the behavioral choice, we performed screening using 1498 mutant strains by the following assay. We presented two kinds of odorants diacetyl (DAc) and benzaldehyde (Bz), both of which elicit positive chemotaxis by activating different sensory neurons, and counted the number of worms near the source of DAc or Bz. As a result, we found that a mutant of metabotropic glutamate receptor mgl-1 showed excessive choice of the chemotaxis toward DAc. The behavioral phenotype of mgl-1 was rescued by injection of a construct, which contains partial genomic sequences including the mgl-1 coding region and the ttx-3 promoter driving gene expression in AIY neurons. Additionally, the extent of rescue was significantly changed according to the copy number of mgl-1 in extra-chromosomal arrays. Furthermore, we tested a mutant of HEN-1, which is secreted from AIY neurons and is involved in another behavioral choice assay. In our behavioral assay, hen-1 worms showed strong choice of the chemotaxis toward Bz, contrary to mgl-1 worms. Furthermore, the phenotype of hen-1;mgl-1 was similar to that of hen-1 suggesting that MGL-1 works upstream of HEN-1. These data suggest that the behavioral phenotype of the mutant was due to the function of MGL-1 in AIY. Next, to investigate the role of AIY neurons in response to complex odorant stimuli, we performed calcium imaging of AIY using microfluidic PDMS chips to fix worms. Because AWC and AWA sensory neurons, which are upstream of AIY, are reported to respond to the removal of Bz and the increase of DAc, we changed the odorant buffers from Bz to DAc buffer to mimic the situation under which the worms receive two kinds of odorant inputs. In wild-type worms, we found that the switching of the odors caused the temporary inhibition and the following activation of AIY, while the AIY are inhibited or activated by the excitation of AWC or AWA, suggesting that AIY received the inputs from both of AWA and AWC. Therefore, we investigated the response of AIY in mgl-1 after the switching of odors and we found that AIY tended to be more excitable just after the switching of odors in mgl-1 than wild-type worms. From these data, it is hypothesized that MGL-1 modulates AIY during the behavioral choice depending on its expression level.

Perreault J et al. (2007) Mol Biol Evol "Ro-associated Y RNAs in metazoans: evolution and diversification."

Perreault J, Perreault JP, Boire G

[Mol Biol Evol, 2007]

The Y genes encode small non-coding RNAs whose functions remain elusive, whose numbers vary between species, and whose major property is to be bound by the Ro60 protein (or its ortholog in other species). To better understand the evolution of the Y gene family, we performed a homology search in 27 different genomes along with a structural search using Y RNA specific motifs. These searches confirmed that Y RNAs are well conserved in the animal kingdom and resulted in the detection of several new Y RNA genes, including the first Y RNAs in insects and a second Y RNA detected in Caenorhabditis elegans. Unexpectedly, Y5 genes were retrieved almost as frequently as Y1 and Y3 genes, and, consequently are not the result of a relatively recent apparition as is generally believed. Investigation of the organization of the Y genes demonstrated that the synteny was conserved among species. Interestingly, it revealed the presence of six putative "fossil" Y genes, all of which were Y4 and Y5 related. Sequence analysis led to inference of the ancestral sequences for all Y RNAs. In addition, the evolution of existing Y RNAs was deduced for many families, orders and classes. Moreover, a consensus sequence and secondary structure for each Y species was determined. Further evolutionary insight was obtained from the analysis of several thousand Y retropseudogenes among various species. Taken together, these results confirm the rich and diversified evolution history of Y RNAs.

Yamaguchi M et al. (2016) Biochim Biophys Acta "NF-Y in invertebrates."

Yoshida H, Ly LL, Yamaguchi M, Ali MS, Yoshioka Y

[Biochim Biophys Acta, 2016]

BothDrosophila melanogaster and Caenorhabditis elegans (C. elegans) are useful model organisms to study in vivo roles of NF-Y during development. Drosophila NF-Y (dNF-Y) consists of three subunits dNF-YA, dNF-YB and dNF-YC. In some tissues, dNF-YC-related protein Mes4 may replace dNF-YC in dNF-Y complex. Studies with eye imaginal disc-specific dNF-Y-knockdown flies revealed that dNF-Y positively regulates the sevenless gene encoding a receptor tyrosine kinase, a component of the ERK pathway and negatively regulates the Sensless gene encoding a transcription factor to ensure proper development of R7 photoreceptor cells together with proper R7 axon targeting. dNF-Y also controls the Drosophila Bcl-2 (debcl) to regulate apoptosis. In thorax development, dNF-Y is necessary for both proper Drosophila JNK (basket) expression and JNK signaling activity that is responsible for thorax development. Drosophila p53 gene was also identified as one of the dNF-Y target genes in this system. C. elegans contains two forms of NF-YA subunit, CeNF-YA1 and CeNF-YA2. C. elegans NF-Y (CeNF-Y) therefore consists of CeNF-YB, CeNF-YC and either CeNF-YA1 or CeNF-YA2. CeNF-Y negatively regulates expression of the Hox gene egl-5 (ortholog of Drosophila Abdominal-B) that is involved in tail patterning. CeNF-Y also negatively regulates expression of the tbx-2 gene that is essential for development of the pharyngeal muscles, specification of neural cell fate and adaptation in olfactory neurons. Negative regulation of the expression of egl-5 and tbx-2 by CeNF-Y provides new insight into the physiological meaning of negative regulation of gene expression by NF-Y during development. In addition, studies on NF-Y in platyhelminths are also summarized.

Burns RG (1996) Trends in Cell Biology "Reply: Defining the gamma-, delta- and epsilon-tubulins."

Burns RG

[Trends in Cell Biology, 1996]

Keeling and Logsdon propose that the y-like sequences from Caenorhabditis elegans and Saccharomyces cerevisiae are bona fide y-tubulins that have undergone rapid evolutionary divergence. Indeed, genetic and localization studies with the yeast epsilon-tubulin (encoded by the TUB4 gene) reveal striking similarities to the bona fide y-tubulins, whereas there is no apparent human analogue to the C. elegans delta-tubulin among the 60 available human y-tubulin expressed-sequence tags. (ESTs).

Gardiner TJ et al. (2009) RNA "A conserved motif of vertebrate Y RNAs essential for chromosomal DNA replication."

Langley AR, Gardiner TJ, Krude T, Christov CP

[RNA, 2009]

Noncoding Y RNAs are required for the reconstitution of chromosomal DNA replication in late G1 phase template nuclei in a human cell-free system. Y RNA genes are present in all vertebrates and in some isolated nonvertebrates, but the conservation of Y RNA function and key determinants for its function are unknown. Here, we identify a determinant of Y RNA function in DNA replication, which is conserved throughout vertebrate evolution. Vertebrate Y RNAs are able to reconstitute chromosomal DNA replication in the human cell-free DNA replication system, but nonvertebrate Y RNAs are not. A conserved nucleotide sequence motif in the double-stranded stem of vertebrate Y RNAs correlates with Y RNA function. A functional screen of human Y1 RNA mutants identified this conserved motif as an essential determinant for reconstituting DNA replication in vitro. Double-stranded RNA oligonucleotides comprising this RNA motif are sufficient to reconstitute DNA replication, but corresponding DNA or random sequence RNA oligonucleotides are not. In intact cells, wild-type hY1 or the conserved RNA duplex can rescue an inhibition of DNA replication after RNA interference against hY3 RNA. Therefore, we have identified a new RNA motif that is conserved in vertebrate Y RNA evolution, and essential and sufficient for Y RNA function in human chromosomal DNA replication.

Erickson DL et al. (2006) J Bacteriol "Serotype differences and lack of biofilm formation characterize Yersinia pseudotuberculosis infection of the Xenopsylla cheopis flea vector of Yersinia pestis."

Hinnebusch BJ, Erickson DL, Wren BW, Jarrett CO

[J Bacteriol, 2006]

Yersinia pestis, the agent of plague, is usually transmitted by fleas. To produce a transmissible infection, Y. pestis colonizes the flea midgut and forms a biofilm in the proventricular valve, which blocks normal blood feeding. The enteropathogen Yersinia pseudotuberculosis, from which Y. pestis recently evolved, is not transmitted by fleas. However, both Y. pestis and Y. pseudotuberculosis form biofilms that adhere to the external mouthparts and block feeding of Caenorhabditis elegans nematodes, which has been proposed as a model of Y. pestis-flea interactions. We compared the ability of Y. pestis and Y. pseudotuberculosis to infect the rat flea Xenopsylla cheopis and to produce biofilms in the flea and in vitro. Five of 18 Y. pseudotuberculosis strains, encompassing seven serotypes, including all three serotype O3 strains tested, were unable to stably colonize the flea midgut. The other strains persisted in the flea midgut for 4 weeks but did not increase in numbers, and none of the 18 strains colonized the proventriculus or produced a biofilm in the flea. Y. pseudotuberculosis strains also varied greatly in their ability to produce biofilms in vitro, but there was no correlation between biofilm phenotype in vitro or on the surface of C. elegans and the ability to colonize or block fleas. Our results support a model in which a genetic change in the Y. pseudotuberculosis progenitor of Y. pestis extended its pre-existing ex vivo biofilm-forming ability to the flea gut environment, thus enabling proventricular blockage and efficient flea-borne transmission.