Sanchez AD et al. (2021) STAR Protoc "A proximity labeling protocol to probe proximity interactions in C.elegans."

Feldman JL, Sanchez AD

[STAR Protoc, 2021]

Enzyme-catalyzed proximity labeling (PL) has emerged as a critical approach for identifying protein-protein proximity interactions in cells; however, PL techniques were not historically practical in living multicellular organisms due to technical limitations. Here, we present a protocol for applying PL to living <i>C.elegans</i> using the biotin ligase mutant enzyme TurboID. We demonstrated PL in a tissue-specific and region-specific manner by focusing on non-centrosomal MTOCs (ncMTOCs) of intestinal cells. This protocol is useful for targeted <i>in vivo</i> protein network profiling. For complete details on the use and execution of this protocol, please refer to Sanchez et al. (2021).

Fan LY et al. (2017) Data Brief "Dataset of the human homologues and orthologues of lipid-metabolic genes identified as DAF-16 targets their roles in lipid and energy metabolism."

Fan LY, Lam EW, Saavedra-Garcia P

[Data Brief, 2017]

The data presented in this article are related to the review article entitled 'Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis' (Saavedra-Garcia et al., 2017) [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.

Delich, Cassandra et al. (2020) MicroPubl Biol

Hebbar, Shilpa, Delich, Cassandra, Zinovyeva, Anna, Dillon, Annabelle, Haskell, Dustin, Winans, Noah

[MicroPubl Biol, 2020]

MicroRNAs (miRNAs) are small, non-coding RNAs that post-transcriptionally repress gene expression (Gebert and MacRae, 2018). While many miRNA genes and their families have been analyzed for function (Miska et al. 2007, Alvarez-Saavedra and Horvitz 2010), there are microRNA genes for which loss of function alleles have not yet been generated. There are no available alleles for the C. elegans mir-49 gene. Using CRISPR-Cas9 genome editing, we generated two deletion alleles, zen99 and zen102, that disrupt the C. elegans mir-49 gene (Fig 1A). mir-49(zen99) and mir-49(zen102) delete 56 base pairs and 58 base pairs from the mir-49 locus, respectively (Fig 1B and Fig 1C). Each deletion nearly completely removes both strands generated by the mir-49 locus, mir-49-3p and mir-49-5p. Both mir-49 alleles are homozygous viable and appear to be superficially wild type. Careful phenotypic analysis will be important to characterize the effects of the two mir-49 deletions.

Yang, Bing et al. MicroPubl Biol

Yang, Bing, McJunkin, Katherine

[MicroPubl Biol, 2020]

The mir-35-42 family of microRNAs (miRNAs) acts redundantly to ensure embryonic viability in C. elegans (Alvarez-Saavedra and Horvitz 2010). We are interested in defining the essential targets that must be repressed by the mir-35-42 family. Our previous work suggested that NHL (ring finger b-box coiled coil) domain containing 2 (nhl-2) may be one such target because genome editing attempts to delete the mir-35-42 seed binding region in the nhl-2 3UTR were unsuccessful (McJunkin and Ambros 2017). The same CRISPR reagents were successful at creating such a deletion in a background containing an NHL-2 CDS deletion (nhl-2(ok818)) (McJunkin and Ambros 2017). Together, we took these results to mean that derepression of nhl-2 induced lethality or sterility, preventing our isolation of the deletion lines in the wild type context. More recently, CRISPR genome editing reagents and protocols have become many-fold more efficient, most notably by injection of recombinant Cas9 RNPs pre-loaded with synthetic guide RNAs (gRNAs) (Paix et al. 2014). Using injection of Cas9/gRNA RNPs, we have succeeded in deleting and mutating the mir-35-42 seed binding region in the nhl-2 3UTR in a wild type background (see alleles in Figure 1A). Because such alleles were previously difficult to generate, we quantified their fecundity and embryonic viability (which are two aspects of physiology affected by mir-35 family mutations) (Alvarez-Saavedra and Horvitz 2010; McJunkin and Ambros 2014) to see if they were impaired, but we found these animals to be wild type (Figure 1B). Therefore, our original interpretation that the difference in CRISPR editing between wild type and nhl-2(ok818) backgrounds was due to negative selection of miRNA binding site mutations in the wild type background was incorrect. One possible explanation for the observed difference in editing may be alterations in chromatin structure induced by the 1.5kb nhl-2(ok818) deletion. Indeed, nucleosome position and dynamics have been shown to alter efficiency of Cas9 cleavage (Chen et al. 2016; Horlbeck et al. 2016; Isaac et al. 2016; Hinz et al. 2016; Daer et al. 2017; Yarrington et al. 2018; Kim and Kim 2018). Thus, differences in genome editing efficiencies between genetic backgrounds should be interpreted with caution.

Horn, Connor et al. (2020) MicroPubl Biol

Hebbar, Shilpa, Sholl, Robert, Zinovyeva, Anna, Haskell, Dustin, Horn, Connor

[MicroPubl Biol, 2020]

MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression during animal development. Large scale efforts to identify functions of individual miRNAs or miRNA families provide invaluable insight into the roles these miRNAs play in organism development (Miska et al. 2007, Alvarez-Saavedra and Horvitz 2010), however, some miRNA genes lack deletion alleles. To our knowledge, no alleles in C. elegans mir-1022 gene are currently available.Using CRISPR/Cas9 genome editing technique, we generated two novel alleles in the mir-1022 locus in C. elegans (Fig 1A). The zen97 allele is a 498 pair deletion of the mir-1022 locus which also inserts GAGGGGATT into that locus (Fig 1B). The zen98 allele is a 508 base pair deletion from the mir-1022 locus, inserting CGGTGTACAATGTATACAATGT in that location (Fig 1B). To specifically target the mir-1022 locus for editing, we used the following guide RNAs: mir-1022_gRNA 1: 5-TCGGGCCAACACATTTCAG-3&#8242; and mir-1022_gRNA 2: 5-TTTGCGTGCGAAAGTGGTGA-3&#8242;. The primers used for PCR genotyping were mir-1022.for3: 5-CTAGTGCATTGTCCAGGCAG-3&#8242; and mir-1022.rev3: 5-CGTGATCTCTTGGTGCACAT-3. The Co-CRISPR marker dpy-10 was used in order to more easily identify worms with active CRISPR/Cas9 as previously described (Arribere et al. 2014). CRISPR components were injected into N2 animals as an RNP complex (Paix et al. 2015). Alt-R Cas9 (cat# 1081058), mir-1022 and dpy-10 Alt-R CRISPR-Cas9 crRNAs (custom), and tracer RNA (cat# 1072532) were purchased from IDT. PCR screening identified two independent mutations, each disrupting the mir-1022 locus (Fig 1), which were subsequently homozygosed and sequenced. UY262 mir-1022(zen97) did not segregate any dumpy, dumpy roller, or roller animals and was not outcrossed. mir-1022(zen98) was outcrossed once to wild type (N2) males to remove a background dpy-10 mutation, generating the 1x outcrossed UY286 mir-1022(zen98) strain. Sequencing was repeated to confirm the mutation.Both alleles are homozygous viable. While not extensively characterized, no gross morphological phenotype was produced by either mir-1022 allele. Further phenotypic analysis will be necessary to determine the exact effect of the two mir-1022 mutations.

Hershberger, Kathleen A et al. (2019) MicroPubl Biol

Meyer, Joel N, Hershberger, Kathleen A, Waters, Tanner A, Leuthner, Tess C

[MicroPubl Biol, 2019]

Arsenic is a toxicant with multiple intracellular targets, including many mitochondrial enzymes. Previous work in C. elegans has shown that strains deficient in complexes I, II, and III (but not complex V) have increased sensitivity to sodium arsenite, suggesting that the electron transport chain is a key target of arsenic toxicity (Luz et al. 2016). However, in that work, the only outcome used to determine strain sensitivity to arsenic was larval growth. Based on these results, we used complex mutants (nuo-6 (complex I), mev-1 (complex II), isp-1 (complex III), and atp-2 (complex V)) to further explore the physiological effects of sodium arsenite induced electron transport chain dysfunction. We used three different assays to ask the same question: which electron transport chain mutant strain is most sensitive to sodium arsenite? Interestingly, we found that strain sensitivity to sodium arsenite depends on the outcome measured. These data indicate that single assays may not provide a complete picture of nematode response to an exposure and suggests that complete characterization of nematode response requires analyzing multiple endpoints. Nematodes were synchronized as L1 larvae by standard egg prep methods. For all experiments, biological replicates were performed with independent egg preps on different days. To minimize the potential for different bleaching events to affect outcomes and confound the strain-specific differences we sought to characterize, strains compared in a given experiment were bleached at the same time, or mutant strain data was normalized to N2s bleached at the same time (exceptions to this statement are the lethality curves generated for nuo-6 and isp-1 mutants at the L4 stage which were performed in isolation on separate days) (Lewis and Felming 1995). First, synchronized nematodes were treated with sodium arsenite in liquid K-medium at concentrations from 0-200 &#956;M for 72 hours at 20 C. Worm length was measured following this exposure using the NIS-Elements BR 3.2 program (Bodhicharla et al. 2014) (Fig. 1A). The concentrations of sodium arsenite used in this assay were lower than those previously reported (Luz et al. 2016) and yielded slightly different results. We found that isp-1 and atp-2 strains had decreased worm length when exposed to low concentrations of sodium arsenite, but that length of the nuo-6 and mev-1 strains were not affected. Next, we measured ATP in worms following sodium arsenite exposure (Fig. 1B). Synchronized worms were exposed to 500 &#956;M sodium arsenite beginning 2 days post hatch for 48 hours. Immediately after the exposure, steady state ATP levels were measured using the Promega CellTiterGlo Luminescent assay and normalized to protein per worm (adapted from Bailey et al. 2016). Although we report no significant differences, there is a strong trend of decreased ATP in the nuo-6 and atp-2 mutant strains. Finally, the 24 hour LC50 to sodium arsenite was determined in the mutant strains at different life stages. Strains were exposed to various concentrations of sodium arsenite for 24 hours at the L4 stage, 8 days of age, and 12 days of age. 10 worms per well (three wells per concentration) were exposed and wells were scored immediately after the exposure to determine percent alive in each well. At the L4 stage, only the mev-1 mutant strain appeared to have altered sensitivity to sodium arsenite. However, in the 8-day old worms, the nuo-6, mev-1, and atp-2 strains were more sensitive to sodium arsenite compared to the N2 strain. This was also observed in the 12-day old worms with the exception that the mev-1 strain did not show increased sensitivity to arsenic. Together, our data shows that strain sensitivity to arsenic is dependent on the outcome measured. For example, the isp-1 strain has decreased growth when exposed to low concentrations of sodium arsenite but does not appear to have differences in ATP content or lethality compared to N2 controls. In contrast, the nuo-6 strain showed no difference in growth compared to N2 controls during sodium arsenite exposure but appeared to have decreased ATP and had a significantly decreased LC50 at 8 and 12 days of life. Additionally, we show that even within the same assay, strains responded differently to sodium arsenite exposure at different life stages. While mev-1 appeared to be most sensitive to sodium arsenite at the L4 stage, the mev-1 strain did not show an increased sensitivity to sodium arsenite in the 12-day old worms. Three separate assays with different exposure concentrations, age of worm, and outcome measured yielded different results to our original research question. This result highlights the importance in toxicology of not just genetic background in modulating sensitivity, but also agei.e., gene environment age interactions. The mechanisms responsible for these differences remain to be determined but may include toxicokinetic (e.g., cuticular and xenobiotic defense mechanisms) as well as toxicodynamic (e.g., differential reliance of specific mitochondrial metabolic processes at different life stages) differences. This work reveals how assay design influences answers to scientific questions, and highlights the importance of measuring multiple outcomes to characterize nematode strains.