Zimmer M (2009) Chem Soc Rev "GFP: from jellyfish to the Nobel prize and beyond."

Zimmer M

[Chem Soc Rev, 2009]

On December 10, 2008 Osamu Shimomura, Martin Chalfie and Roger Tsien were awarded the Nobel Prize in Chemistry for "the discovery and development of the green fluorescent protein, GFP". The path taken by this jellyfish protein to become one of the most useful tools in modern science and medicine is described. Osamu Shimomura painstakingly isolated GFP from hundreds of thousands of jellyfish, characterized the chromophore and elucidated the mechanism of Aequorean bioluminescence. Martin Chalfie expressed the protein in E. coli and C. elegans, and Roger Tsien developed a palette of fluorescent proteins that could be used in a myriad of applications.

Sherry, Tessa et al. MicroPubl Biol

Pocock, Roger, Sherry, Tessa, Nicholas, Hannah R

[MicroPubl Biol, 2020]

CWN-2 is one of five C. elegans Wnt ligands, with known roles in neuron migration, axon guidance and nerve ring placement (reviewed in (Sawa and Korswagen, 2013)). CWN-2 is highly expressed in the SMDD neurons (Kennerdell et al., 2009; Taylor et al., 2019), and therefore we were interested in determining whether CWN-2 regulates SMDD axonal development.We used the cwn-2(ok895) deletion allele to analyze SMDD axonal development. We found that loss of cwn-2 caused a defective SMDD axonal phenotype, where axons do not extend along the dorsal sublateral cord, suggesting that the axons did not exit the nerve ring due to defects in axon outgrowth or guidance (Figure 1A-C). To ensure that this phenotype was due to the loss of CWN-2 function, we transgenically expressed cwn-2 cDNA driven by the ctbp-1a promoter, which drives expression in SMDD and ten other head neurons (Sherry et al., 2020). Expressing cwn-2 using this promoter partially rescues the defective axonal phenotype (Figure 1C). This suggests that CWN-2 controls SMDD development in an autocrine manner and/or non-autonomously from other head neurons.Next, we investigated which Wnt receptor controls SMDD axonal development. There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). CAM-1 was previously shown to function as a CWN-2 receptor for SIA, SIB and RMED/V posterior-directed neurite outgrowth (Kennerdell et al., 2009; Song et al., 2010; Wang and Ding, 2018). The SIA, SIB, RMED/V and SMDD motor neuron cell bodies are all positioned in the nerve ring and extend posteriorly-directed axons (White et al., 1986). Therefore, our data show that CWN-2 and CAM-1 have a common role in controlling axon extension in posteriorly-directed lateral or sublateral axons.

Godini, Rasoul et al. MicroPubl Biol

Pocock, Roger, Godini, Rasoul, Langebeck-Jensen, Kasper

[MicroPubl Biol, 2020]

The BAG neurons control multiple aspects of Caenorhabditis elegans behavior, such as sensing environmental gases (oxygen and carbon dioxide), regulation of systemic fat levels and egg laying (Brandt et al. 2012; Guillermin et al. 2011; Juozaityte et al. 2017; Zimmer et al. 2009). To identify factors that control BAG specification, we performed a forward genetic mutagenesis screen using the Pgcy-33::gfp reporter, which is exclusively expressed in the BAG neurons. We isolated a new allele (rp4) that exhibits a loss of Pgcy-33::gfp expression. Using the one-step whole-genome sequencing and SNP mapping strategy (Doitsidou et al. 2010) we mapped the genetic lesion to the egl-46 gene, encoding a zinc finger transcription factor homologous to mammalian INSM1/2, which we had previously shown to be important for BAG specification (Rojo Romanos et al. 2015). The new lesion we identified egl-46(rp4) (TGC>TAC) causes a single amino acid change in a highly conserved cysteine residue (C185Y) that lies in the first zinc finger domain of EGL-46, which would be predicted to affect DNA binding. Analysis of Pgcy-33::gfp expression in the rp4 allele reveals that it exhibits the same phenotype as the previously published rp13 deletion allele, which is an out-of-frame deletion that removes the zinc finger domains (Rojo Romanos et al. 2015). Therefore, rp4 acts as a strong loss-of-function/null allele and may be of use to those researchers interested in elucidating additional functions of EGL-46.

Sherry, Tessa et al. (2019) MicroPubl Biol

Pocock, Roger, Nicholas, Hannah R, Sherry, Tessa

[MicroPubl Biol, 2019]

We have generated new putative null alleles of two members of the C. elegans Hedgehog-related pathway: wrt-6 and wrt-10. The warthog (wrt) family member wrt-6 encodes a predicted secreted signalling molecule that contains an N-terminal Wart domain and a C-terminal autoprocessing domain (Hint or Hog domain) (Brglin 1996; Aspck et al. 1999; Brglin, 2008). wrt-10 encodes another member of this Wrt family that contains the Wart domain but lacks the Hog domain (Brglin 1996; Aspck et al. 1999).To generate deletion alleles, we used CRISPR-Cas9 to target the first exon of wrt-6 or wrt-10 (wrt-6 sgRNA: 5′-GATGCTGTTACACCTCGTGT-3′, wrt-10 sgRNA: 5′-GCGGATTCCATTCATGATGG-3′). We isolated the wrt-6 (aus41) allele that contains a 49 bp out-of-frame deletion, predicted to cause a premature stop codon after 7 amino acids (Figure 1A). We also generated two wrt-10 deletion alleles: aus36 and aus37. The aus36 allele contains a 5 bp deletion, predicted to cause a premature stop codon after 33 amino acids (Figure 1B). The aus37 allele contains a 2 bp deletion, predicted to cause a premature stop codon after 34 amino acids (Figure 1B). As all these alleles are predicted to cause premature stop codons in the first exon of each gene, they are likely to represent molecular nulls. We found that these alleles are viable and have no obvious gross morphological phenotype. Therefore, in-depth phenotypic examination is required to dissect their functional role. To conclude, we have isolated specific deletion alleles for wrt-6 and wrt-10 and will therefore help reveal new insights into the functions of Hedgehog-related signaling in C. elegans.

Rahe, Dylan et al. MicroPubl Biol

Cosmanescu, Filip, Carrera, Ines, Rahe, Dylan, Hobert, Oliver

[MicroPubl Biol, 2019]

The immunoglobulin superfamily member sax-7 produces a long and short isoform that appear to have distinct functions (Chen et al. 2001; Wang et al. 2005; Sasakura et al. 2005; Pocock et al. 2008). An isoform-specific allele for the long isoform, sax-7L, was previously reported (Sasakura et al. 2005), but an isoform-specific allele for the short isoform, sax-7S, has been lacking (Fig. 1A). We used CRISPR/Cas9 to generate such an allele, using the unc-22 co-CRISPR method (Kim et al. 2014). The ot820 allele was isolated using sgRNA targeted to the first exon of sax-7S (sgRNA sequece: 5 - TGGGGTTACGAGAGACGAT - 3). Twitching progeny were screened by PCR and Sanger sequencing, and an 8bp deletion 15bp from the start codon was isolated (screening primers: 5 - GGTGCTTCTCTGGTGGTAGC - 3 and 5 - TGTTGGCAAACAAAATACACG - 3, Fig. 1B). While the sax-7L isoform is predicted to be entirely unaffected by this allele, the resultant frameshift is predicted to generate a 49 amino acid protein in which all but the first five amino acids of sax-7S are aberrant and has no predicted signal sequence, before terminating in a premature stop in the second exon (Fig. 1B). This allele therefore likely represents a null for the sax-7S isoform. After we generated this allele, a recent paper reported an additional sax-7S-specific allele, with somewhat similar, but not identical sequence properties (Chen et al., 2019). Consistent with previous evidence of distinct functions of sax-7 isoforms, these authors showed differing axon fasciculation defects between these two alleles, which is further distinct from a total null allele. These new sax-7S alleles should help to reveal new insights into the role of L1CAM/SAX-7 isoforms in the nervous system.