Hannah Nicholas et al. (2007) International Worm Meeting "The C. elegans CTBP-1 repressor protein contains a DNA-binding THAP domain."

Joel Mackay, Chu Kong Liew, Tina Wu, Merlin Crossley, Hannah Nicholas

[International Worm Meeting, 2007]

Transcriptional co-repressors of the C-terminal binding protein (CtBP) family interact with other proteins that contain amino acid motifs of the form PXDLS. These motifs occur in many transcription factors, and serve to recruit CtBP and its associated repression complex to DNA-regulatory elements. In mammals there are two CtBP genes, with overlapping functions. Disruption of both genes leads to early lethality. In C. elegans there is a single CtBP-related gene. We have shown that the worm CtBP (CTBP-1) binds PXDLS-containing transcription factors and can repress transcription, indicating that the nematode protein is functionally orthologous to other CtBPs. C. elegans therefore provides a tractable model system for investigating CtBP function. Interestingly, the CTBP-1 protein contains an additional domain not found in other characterised members of the CtBP family, which homology searches have identified as a THAP domain. We have shown that this domain can bind to double-stranded DNA and, through site-selection experiments, we have identified a consensus binding sequence. Using nuclear magnetic resonance spectroscopy we have determined the structure of the THAP domain of CTBP-1 and shown that it contains a positively charged face that may correspond to the DNA-contact surface. The C. elegans CtBP protein is the first CtBP protein with intrinsic DNA-binding capacity and may serve as a DNA-binding transcriptional repressor in vivo. In order to examine the in vivo roles of CTBP-1, we have obtained a ctbp-1 deletion allele from the C. elegans knockout consortium. Worms carrying this allele display a mild uncoordinated phenotype. Progress towards a molecular understanding of this phenotype will be presented.

Hannah Nicholas et al. (2007) First Australian C. elegans Meeting "Caenorhabditis elegans as a model in which to investigate the functions of a transcriptional co-repressor"

Joel Mackay, Hannah Nicholas, Tina Wu, Merlin Crossley, Chu Kong Liew

[First Australian C. elegans Meeting, 2007]

Transcriptional co-repressors of the C-terminal binding protein (CtBP) family interact with other proteins that contain amino acid motifs of the form PXDLS. These motifs occur in many transcription factors, and serve to recruit CtBP and its associated repression complex to DNA-regulatory elements. In mammals there are two CtBP genes, with overlapping functions. Disruption of both genes leads to early lethality. We have identified a single CtBP-related gene in C. elegans. This worm CtBP (CTBP-1) binds PXDLS-containing transcription factors and can repress transcription, indicating that the nematode protein is functionally orthologous to other CtBPs. C. elegans therefore provides a tractable model system for investigating CtBP function. We have begun investigating CTBP-1. This protein contains an additional domain not found in other characterised members of the CtBP family, which homology searches have identified as a THAP domain. We have shown that the domain can bind to double-stranded DNA. We have also determined the structure of this domain and shown that it contains a positively charged face that may correspond to the DNA-contact surface. The C. elegans CtBP protein is the first CtBP protein with an intrinsic DNA-binding function and may serve as a DNA-binding transcriptional repressor in vivo.. In order to examine the in vivo roles of CTBP-1, we have obtained a ctbp-1 deletion allele from the C. elegans knockout consortium. Worms carrying this allele display a mild uncoordinated phenotype. Progress towards a molecular and cellular explanation of this phenotype will be presented.

Morrison, Kayleigh N. et al. (2021) MicroPubl Biol

Morrison, Kayleigh N., Ragle, James Matthew, Shakes, Diane C., Uyehara, Christopher M., Ward, Jordan D.

[MicroPubl Biol, 2021]

During the process of cell differentiation, specific cytoskeletal proteins can sequentially assemble into a wide variety of diverse molecular superstructures. Nematode spermatogenesis provides a powerful system for studying these transitions since sperm-specific transcription ceases prior to the meiotic divisions and translation ceases shortly thereafter (Chu and Shakes, 2013). Therefore, structural transitions that follow the meiotic divisions must be carried out by the remodeling of already synthesized proteins. The Major Sperm Protein (MSP) is a nematode-specific cytoskeletal element whose polymerization dynamics drive the pseudopod-based motility of the activated sperm (Roberts, 2005). In C. elegans, MSP additionally functions as the extracellular signaling molecule for triggering both ovulation and oocyte maturation (Miller et al., 2003). MSP is highly abundant in sperm, where it reaches 10-15% of total and 40% of soluble cellular protein (Roberts 2005). Within developing spermatocytes, MSP is packaged into fibrous bodymembranous organelle (FB-MO) complexes (Fig. 1A, Roberts et al., 1986). By assembling into paracrystalline FBs, MSP is both sequestered away from the critical meiotic processes of chromosome segregation and cytokinesis while also being packaged for efficient segregation into spermatids during the post-meiotic partitioning process (Chu and Shakes 2013, Nishimura and LHernault, 2010, Price et al., 2021). Following the meiotic divisions and sperm individualization, FBs disassemble, and MSP disperses as dimers throughout the spermatid cytoplasm (Fig. 1A). When sperm activate to form motile spermatozoa, MSP polymerization within the pseudopod drives the motility of the crawling sperm (Chu and Shakes, 2013). Thus, MSP exists in at least three distinct molecular states: 1) in highly organized paracrystalline FBs within developing spermatocytes 2) as unpolymerized dimers within spermatids, and 3) in dynamically polymerizing filaments and fibers within crawling spermatozoa.

Jeffers, Tess E. et al. (2013) International Worm Meeting "Nucleosome organization in C. elegans gamete chromatin."

Lieb, Jason D., Jeffers, Tess E.

[International Worm Meeting, 2013]

We are interested in how the genome is packaged in gametes (sperm and oocytes), and how differences might contribute to the specification of zygotic gene expression programs. Using fem-1 and him-5 mutants, we separately isolated pure populations of C. elegans sperm and oocytes and performed RNA-seq and nucleosome mapping through MNase-seq. Preliminary transcriptome analysis reveals ~700 transcripts with higher relative levels in sperm, and ~2000 transcripts with higher relative levels in oocytes, in agreement with quantities reported by previous microarray and proteomics experiments (Reinke et al., Mol. Cell 2000 & Development 2004, Chu et al., Nature 2006). Sperm are enriched in transcripts encoding proteins that function in the cytoskeleton, as chaperones, and in the mitochondria while oocytes are enriched for transcripts that encode proteins functioning in mRNA processing, mitosis and meiosis. By integrating our nucleosome and transcriptome data, we find nucleosome depletion at the promoters of genes highly transcribed in the germline. Future experiments will investigate the use of differential histone isoforms and histone modifications in gamete genome packaging.

Au C et al. (2008) Neurotoxicology "Manganese transport in eukaryotes: the role of DMT1."

Au C, Benedetto A, Aschner M

[Neurotoxicology, 2008]

Manganese (Mn) is a transition metal that is essential for normal cell growth and development, but is toxic at high concentrations. While Mn deficiency is uncommon in humans, Mn toxicity is known to be readily prevalent due to occupational overexposure in miners, smelters and possibly welders. Excessive exposure to Mn can cause Parkinson''s disease-like syndrome; patients typically exhibit extrapyramidal symptoms that include tremor, rigidity and hypokinesia [Calne DB, Chu NS, Huang CC, Lu CS, Olanow W. Manganism and idiopathic parkinsonism: similarities and differences. Neurology 1994;44(9):1583-6; Dobson AW, Erikson KM, Aschner M. Manganese neurotoxicity. Ann NY Acad Sci 2004;1012:115-28]. Mn-induced motor neuron diseases have been the subjects of numerous studies; however, this review is not intended to discuss its neurotoxic potential or its role in the etiology of motor neuron disorders. Rather, it will focus on Mn uptake and transport via the orthologues of the divalent metal transporter (DMT1) and its possible implications to Mn toxicity in various categories of eukaryotic systems, such as in vitro cell lines, in vivo rodents, the fruitfly, Drosophila melanogaster, the honeybee, Apis mellifera L., the nematode, Caenorhabditis elegans and the baker''s yeast, Saccharomyces cerevisiae.

Munoz NR et al. (2018) MicroPubl Biol "New allele of C. elegans gene spch-3 (T27A3.4), called xc2"

Munoz NR, Chu D, Byrd DT

[MicroPubl Biol, 2018]

We created a new mutant allele, named xc2, of the gene spch-3 (T27A3.4). spch-3 encodes one of three C. elegans small, highly basic proteins that resemble invertebrate protamines and associate with sperm meiotic chromosomes (Chu et al., 2006). The alleles were isolated from gene mutations generated by Non-Homologous End Joining (NHEJ) mediated repair of Cas9-generated breaks (Dickinson et al., 2013; Ran et al., 2013). The alleles were discovered using PCR with the following primers 5- CCCTCGTCTTCTCTACTAGA -3 and 5- CATAGCTTCACAGGGAGAAG -3. Next Generation Sequencing let us identify 30 bp flanking sequences of the xc2 allele as GTCCGTCAACCCGCCGTTCGTCGTCTCGTC - [191 bp deletion] - TCTCGTCATCGCTCATCTTCGAAGGCTCGT. Wildtype spch-3 has 2 exons. The xc2 mutation is located in the second exon (Fig. 1A). In the mutant, while the first 97 amino acids of the mutant protein remain wildtype, they are followed by the deletion causing a frameshift mutation that adds 25 mutant amino acids (LSSSLIFEGSWTSCVDCKEDSCQKT) before the first resulting stop codon (Fig. 1B). Therefore, out of the 203 amino acids in the wildtype SPCH-3 protein, only the first 97 remain in the xc2 allele. Although the additional 25 amino acids may have an effect that is yet to be determined, the mutation in the second exon changes about 52% of the protein providing a unique opportunity to understand the function of SPCH-3 through mutant studies.

Chung Man Chan et al. (2006) East Asia C. elegans Meeting "Sex pheromone in dioecious nematode: its production and perception"

King L. Chow, Chung Man Chan, Jeffrey Chasnov, Wai Kar So

[East Asia C. elegans Meeting, 2006]

Two different mating systems are adopted by Caenorhabditis species, that is dioecy and androdioecy. For dioecious species, finding a mating partner is an obligatory process for survival. We have identified a sex-specific attractant produced by females of the dioecious Caenorhabditis remanei for attracting the mating partners. We have further characterized the nature and the constituents of this sex pheromone-like substance, the locale of its production, its perception requirement and related sex pheromones produced by other Caenorhabditis species. These attractant substances are produced by the somatic gonad as confirmed by laser ablation of gonadal progenitor cells in different combination. Their activity could be abolished by mating and can be recovered in the absence of further mating. While perception of these attractants could be observed in males of the androdioecious C. elegans, the perception pathway was delineated by repeated testing of various genetic mutants affecting either specific cell fate or molecular function. Our results show that two different sensory neurons and an interneuron are required. Moreover, a signaling pathway dependent of kinase activity and G-protein subunit are found to be crucial for the pheromone perception. A hypothesis of conservation of the pheromone perception pathway across different species will be discussed. (The research is funded by Research Grants Council, Hong Kong.)

Wan, Xuan et al. (2017) International Worm Meeting "Identification of nematodes volatile sex pheromone and the molecular basis of its perception."

WAN, Xuan, Chow, King L.

[International Worm Meeting, 2017]

Nematodes rely on their sensory modalities to locate mating partner. Volatile sex pheromone attracts potential mating partners from afar. Intriguingly, sexually matured females C. remanei and self-sperm exhausted hermaphrodites C. elegans produce a volatile attractant that is detectable by both con-specific and its relative adult males, qualifying this attractant as a long-range sex pheromone. We previously reported a class D GPCR serpentine receptor (SRD-1), a receptor in AWA neuron, is responsible for detecting this pheromone and several components in the olfactory pathway are involved in this pheromone signal transduction. The GC-MS results of chemo-attractants from female C. remanei verified several volatile chemicals. Two of them exhibited sex-, stage-, and species-specific attractiveness on wild-type males. Noticeably, these compounds could neither attract receptor-defective mutant nor pheromone-perception-defective mutant males. We also visualized AWA neuron excitation by employed a calcium indicator, GCaMP5. The excitation of the AWA neurons was observed only in wild-type males, but not in srd-1 mutants, upon induction by both candidates separately. We concluded that these two chemicals are the active components of this pheromone through the GC-MS analysis, signal transduction pathway mutant strain studies and also the demonstration of ligand-receptor relationships in calcium imaging and behavioural assays. (The study is supported by Research Grants Council, Hong Kong.)

FU, Lan et al. (2011) International Worm Meeting "The identification of the functional components of the male-specific CEM neurons."

Chow, King L., Fu, Lan, CHAN, Gus C. M.

[International Worm Meeting, 2011]

CEMs are the only four male-specific cephalic neurons located in the head region of Caenorhabditis elegans. They are required for sex pheromone perception possibly for sensory input (Chasnov et al., 2007). However, their specific role and molecular function in this process is largely unknown. In order to define the cellular identity of CEM and active elements conferring its function, we are analyzing the CEMs' transcriptome using Illumina sequencing technique. Although ced-4 mutant hermaphrodites have non-functional CEMs preserved, these animals are not able to respond to sex pheromone. Ectopic fem-3 expression in the nervous system could masculinize CEMs and significantly raised the sensitivity of ced-4 hermaphrodites to sex pheromone. Some cellular properties of CEM could also be partially restored with this fem-3 expression. PolyA RNA from the functional CEMs was obtained from such masculinized ced-4 mutant hermaphrodites and was compared with the polyA RNA from ced-4 mutant hermaphrodites with feminized CEMs. FLAG-tagged poly(A)-binding protein (PABP) was expressed under the CEM-specific pkd-2 promoter and the protein product crosslinked with the CEM-specific polyA RNA. The uniquely expressed or highly enriched RNA species in these functional CEMs are recovered. These unique components reflecting the molecular properties of CEM will be presented, where their potential involvement of the biological activity in the CEMs will be discussed. (The study is supported by Research Grants Council, Hong Kong.).

Li, Ching-Ki et al. (2015) International Worm Meeting "The male-specific CEM neurons sense sex pheromone via Go-mediated signaling in C. elegans."

CHOW, King-Lau, Li, Ching-Ki

[International Worm Meeting, 2015]

Finding a mating partner is an obligated process for the survival of sexual species. C. elegans males show prominent chemo-attractive response to the sex pheromone released by females of a dioecious species - C. remanei, implicating a mating cue. This chemotactic response towards sex pheromone is controlled by a pair of male-specific CEM neurons. Despite its role in chemo-sensation implicated by their ciliary endings, the biological function of these neurons remains elusive. We showed that C. elegans males lacking intact CEM cilia by depleting IFT (Intraflagellar transport) proteins displayed a notable weakened sex pheromone response, suggesting that CEMs are sensory neurons. We also sought to identify the molecular components acting in CEMs, including G proteins. The C. elegans genome encodes 21 G-alpha, 2 G-beta and 2 G-gamma subunits. We systematically examined the expression of these genes in CEM and evaluated their function in CEM by cell-specific knockdown. We found that goa-1 (gene encoding G-alpha), gpb-1 (gene encoding G-beta) and gpc-2 (gene encoding G-gamma) are expressed in CEMs, and knockdown of these genes impaired animal response towards sex pheromone. These results indicate Go-mediated signaling occurs in the CEMs to regulate sex pheromone chemotaxis. How these G proteins are coupled with the receptor for sex pheromone perception by CEM will be discussed. (This study is supported by Research Grants Council, Hong Kong.).